Exercises: alignment

What ever kind analysis you want to achieve with Phylemon, alignment is a fundamental part of the process. It make no sense to use the best model of substitution, or to test for positive selection if your alignment have one extra gap.

Information about the most general options selected for Phylemon interface, is available at the Official User Guide page.

For this practices go to the Phylemon web server (you can login if you want to keep a trace of this exercises) and in the Tools section expand, if it is not, the Alignment menu and click on the Mucle link.

• Fill the form with the example available, the p53 sequences.
• Have a look to the p53_cdnaln.fasta file by clicking on the file name.
• Have a look at the different options corresponding to the example you filled.
  1. Do you agree with the choice of the different parameters? Why?
  2. Supposing that you know you are working with close related sequences, how would you change them to run Muscle in a faster way?
  3. Imagine You are now working with huge sequences are there possibilities to run Muscle without consuming all memory of the server and being banned for ever from Phylemon?

Answers

Information about the most general options selected for Phylemon interface, is available at the Official LAGAN TOOLKIT USER MANUAL.

For this practices go to the Phylemon web server (you can login if you want to keep a trace of this exercises) and in the Tools section expand, if it is not, the Alignment menu and click on the Lagan link.

• Have a look at the different options corresponding to the example you filled.
• Fill the form with the example available, the brca2 sequences.
• Have a look to the lagan_brca2.fasta file by clicking on the file name.
  1. Do you agree with the choice of the different parameters? Why?
  2. This is the error returned by Phylemon when giving as input a file of the type:

>spe1
ATTACGATTACGATTACATTACGATTACGATTACATTACGATTACGATTACATTACGATTACGATTAC
>spe2
ATTACGATTACGATTACATTACGATTACGATTACATTACGATTACGATTACATTACGATTACGATTAC
>spe3
ATTACGATTACGATTACATTACGATTACGATTACATTACGATTACGATTACATTACGATTACGATTAC

Error executing LAGAN
Please, check out the execution log file
 
--- begin of log file
Invalid option for lagan: fasta_files/pro_365.fasta/usr/local/lagan20//lagan.pl fasta_files/hsa_0.fasta fasta_files/rno_191.fasta fasta_files/pro_365.fasta -translate  -mfa -out lagan.out
 
--- end of log file

What would be your solution?

Answers